Transcript: Human NM_001321826.2

Homo sapiens niban apoptosis regulator 3 (NIBAN3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
NIBAN3 (199786)
Length:
2355
CDS:
75..2075

Additional Resources:

NCBI RefSeq record:
NM_001321826.2
NBCI Gene record:
NIBAN3 (199786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162462 CTAACTGGATATTGGCAGCTT pLKO.1 1909 CDS 100% 2.640 3.696 N NIBAN3 n/a
2 TRCN0000163878 CGCAGGGAGGTTTACTCATTT pLKO.1 1236 CDS 100% 13.200 9.240 N NIBAN3 n/a
3 TRCN0000160277 CAAATCTTAACTTGGTGTCAA pLKO.1 1828 CDS 100% 4.950 3.465 N NIBAN3 n/a
4 TRCN0000164623 CTGAATCCTTGGGAGACCATA pLKO.1 490 CDS 100% 4.950 3.465 N NIBAN3 n/a
5 TRCN0000136546 CAATGATGTATCCTGCACTCT pLKO.1 1763 CDS 100% 2.640 1.848 N NIBAN3 n/a
6 TRCN0000159234 CCAAATCTTAACTTGGTGTCA pLKO.1 1827 CDS 100% 2.640 1.848 N NIBAN3 n/a
7 TRCN0000138534 CGTGTGTTCTTGGTTCAGCTT pLKO.1 1977 CDS 100% 2.640 1.848 N NIBAN3 n/a
8 TRCN0000159079 GCTGAAGAAATTCAAATCGGA pLKO.1 1514 CDS 100% 0.750 0.525 N NIBAN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.