Transcript: Human NM_001322254.2

Homo sapiens jumonji domain containing 1C (JMJD1C), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
JMJD1C (221037)
Length:
8585
CDS:
800..7765

Additional Resources:

NCBI RefSeq record:
NM_001322254.2
NBCI Gene record:
JMJD1C (221037)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322254.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107563 CCCATTTACTAGCCGGATCAT pLKO.1 2427 CDS 100% 4.950 6.930 N JMJD1C n/a
2 TRCN0000107562 GCGGAATCAATTAGTCTTGAT pLKO.1 6764 CDS 100% 0.495 0.693 N JMJD1C n/a
3 TRCN0000107564 GCCTCTCATTTGCCAGGATTT pLKO.1 7040 CDS 100% 10.800 8.640 N JMJD1C n/a
4 TRCN0000358696 GAGATGTGGAGACCTAATAAT pLKO_005 3962 CDS 100% 15.000 10.500 N JMJD1C n/a
5 TRCN0000358763 GGATCTGTGAGAAGCATATTT pLKO_005 6624 CDS 100% 15.000 10.500 N JMJD1C n/a
6 TRCN0000358695 TCCACCTCCAGAGACTATAAA pLKO_005 1993 CDS 100% 15.000 10.500 N JMJD1C n/a
7 TRCN0000107560 GCTCCTGTGATTCAATGTTAT pLKO.1 7933 3UTR 100% 13.200 9.240 N JMJD1C n/a
8 TRCN0000107561 GCGTCCATCTTCTAGTACAAA pLKO.1 4063 CDS 100% 5.625 3.938 N JMJD1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322254.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.