Transcript: Human NM_001323089.2

Homo sapiens Janus kinase and microtubule interacting protein 3 (JAKMIP3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
JAKMIP3 (282973)
Length:
6171
CDS:
254..2566

Additional Resources:

NCBI RefSeq record:
NM_001323089.2
NBCI Gene record:
JAKMIP3 (282973)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137023 CCTGATTTACTCGGCAAGATA pLKO.1 4292 3UTR 100% 5.625 7.875 N JAKMIP3 n/a
2 TRCN0000136569 CTGGCTCAGCAGAGAATTAAA pLKO.1 2438 CDS 100% 15.000 10.500 N JAKMIP3 n/a
3 TRCN0000137067 CCTTAGCTTTCATTCTCTGGT pLKO.1 2541 CDS 100% 2.640 1.848 N JAKMIP3 n/a
4 TRCN0000134302 GCCAGAAATGTACTGTTACAT pLKO.1 5357 3UTR 100% 0.563 0.394 N JAKMIP3 n/a
5 TRCN0000138074 GCTGATGAAGAAGCTGGACAT pLKO.1 1996 CDS 100% 4.050 2.430 N JAKMIP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.