Transcript: Human NM_001323294.2

Homo sapiens zinc finger protein 197 (ZNF197), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ZNF197 (10168)
Length:
2939
CDS:
190..993

Additional Resources:

NCBI RefSeq record:
NM_001323294.2
NBCI Gene record:
ZNF197 (10168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234350 AGACCTCCCACCTACACTTTA pLKO_005 305 CDS 100% 13.200 6.600 Y ZNF197 n/a
2 TRCN0000018054 CCACCTACACTTTAGACAATT pLKO.1 312 CDS 100% 13.200 6.600 Y ZNF197 n/a
3 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 919 CDS 100% 13.200 6.600 Y Zfp874a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.