Transcript: Human NM_001324118.2

Homo sapiens progestin and adipoQ receptor family member 4 (PAQR4), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PAQR4 (124222)
Length:
2484
CDS:
328..948

Additional Resources:

NCBI RefSeq record:
NM_001324118.2
NBCI Gene record:
PAQR4 (124222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324118.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423149 ACAGCAGCCTCCTAGAGTTAG pLKO_005 969 3UTR 100% 10.800 8.640 N PAQR4 n/a
2 TRCN0000060618 CCGTGCTCTATCACCTCTTTA pLKO.1 614 CDS 100% 13.200 9.240 N PAQR4 n/a
3 TRCN0000124453 GCACCTGCAGTTCAATAAGTT pLKO.1 378 CDS 100% 5.625 3.938 N Paqr4 n/a
4 TRCN0000317476 GCACCTGCAGTTCAATAAGTT pLKO_005 378 CDS 100% 5.625 3.938 N Paqr4 n/a
5 TRCN0000420671 ACGTCTTGCTCTGAGAGTTCA pLKO_005 1259 3UTR 100% 4.950 3.465 N PAQR4 n/a
6 TRCN0000060619 GCAGTTCAATAAGTTCGTGCT pLKO.1 384 CDS 100% 2.160 1.512 N PAQR4 n/a
7 TRCN0000060622 CCTGGTGGGCTACACTGTGTT pLKO.1 774 CDS 100% 1.650 1.155 N PAQR4 n/a
8 TRCN0000060620 CCTGCACAACGAACTGGGCAA pLKO.1 459 CDS 100% 0.720 0.504 N PAQR4 n/a
9 TRCN0000124451 CTGCAGTTCAATAAGTTCGTA pLKO.1 382 CDS 100% 3.000 2.100 N Paqr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324118.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.