Transcript: Human NM_001324192.1

Homo sapiens pantothenate kinase 2 (PANK2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-05
Taxon:
Homo sapiens (human)
Gene:
PANK2 (80025)
Length:
1506
CDS:
168..1163

Additional Resources:

NCBI RefSeq record:
NM_001324192.1
NBCI Gene record:
PANK2 (80025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162362 GATCGACTGGGCTCTTACAG pXPR_003 CGG 569 57% 1 0.1865 PANK2 PANK2 76811
2 BRDN0001144887 AATGAGAGGCTATCGTGACG pXPR_003 GGG 132 13% 1 0.1767 PANK2 PANK2 76812
3 BRDN0001162474 CGCAGGAAGCCAATCCGACG pXPR_003 AGG 226 23% 1 -0.3645 PANK2 PANK2 76810
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037737 CGTACAAATTTGAGCAGGATT pLKO.1 1120 CDS 100% 4.950 6.930 N PANK2 n/a
2 TRCN0000025589 GCAAAGGCAATCTGCACTTTA pLKO.1 1000 CDS 100% 13.200 9.240 N Pank2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.