Transcript: Human NM_001324237.2

Homo sapiens inosine triphosphatase (ITPA), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ITPA (3704)
Length:
1275
CDS:
630..962

Additional Resources:

NCBI RefSeq record:
NM_001324237.2
NBCI Gene record:
ITPA (3704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050519 GAGATAAGTTTCCATGCACTT pLKO.1 375 5UTR 100% 4.050 5.670 N ITPA n/a
2 TRCN0000050521 CGTTCAGATTCTAGGAGATAA pLKO.1 361 5UTR 100% 13.200 9.240 N ITPA n/a
3 TRCN0000358596 GTGGTTTCTGGAGAAGTTAAA pLKO_005 559 5UTR 100% 13.200 9.240 N ITPA n/a
4 TRCN0000358660 GAAAGGACCTTGGGTGGTAAA pLKO_005 1126 3UTR 100% 10.800 7.560 N ITPA n/a
5 TRCN0000358597 TCGAGGACAAGTCAGCCTATG pLKO_005 612 5UTR 100% 6.000 4.200 N ITPA n/a
6 TRCN0000050520 GAGCCGGATGAGATTTCCATA pLKO.1 434 5UTR 100% 4.950 3.465 N ITPA n/a
7 TRCN0000050518 GCAGGAGTACTTTGGCAGTTT pLKO.1 847 CDS 100% 4.950 3.465 N ITPA n/a
8 TRCN0000050522 TGATGGATATGAGCAGACGTA pLKO.1 763 CDS 100% 2.640 1.848 N ITPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.