Transcript: Human NM_001324318.2

Homo sapiens SHC binding and spindle associated 1 (SHCBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
SHCBP1 (79801)
Length:
5063
CDS:
21..1925

Additional Resources:

NCBI RefSeq record:
NM_001324318.2
NBCI Gene record:
SHCBP1 (79801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129943 GCTTGAGTGAAAGGTAGATTT pLKO.1 2039 3UTR 100% 13.200 9.240 N SHCBP1 n/a
2 TRCN0000342954 GCTTGAGTGAAAGGTAGATTT pLKO_005 2039 3UTR 100% 13.200 9.240 N SHCBP1 n/a
3 TRCN0000129773 CTTGGTGAAACCTACAATCTT pLKO.1 1541 CDS 100% 5.625 3.938 N SHCBP1 n/a
4 TRCN0000343016 CTTGGTGAAACCTACAATCTT pLKO_005 1541 CDS 100% 5.625 3.938 N SHCBP1 n/a
5 TRCN0000129840 CCAATTACAGTGAGTCTGATT pLKO.1 2334 3UTR 100% 4.950 3.465 N SHCBP1 n/a
6 TRCN0000352737 CCAATTACAGTGAGTCTGATT pLKO_005 2334 3UTR 100% 4.950 3.465 N SHCBP1 n/a
7 TRCN0000127676 CCTGGCCATTATGTGGTACAT pLKO.1 1062 CDS 100% 4.950 3.465 N SHCBP1 n/a
8 TRCN0000128094 CGAGGAAGTAAGGAAGGGAAT pLKO.1 2243 3UTR 100% 4.050 2.835 N SHCBP1 n/a
9 TRCN0000352800 CGAGGAAGTAAGGAAGGGAAT pLKO_005 2243 3UTR 100% 4.050 2.835 N SHCBP1 n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3851 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
11 TRCN0000248577 TCCATGGTGGAAGGGTTAAAT pLKO_005 747 CDS 100% 15.000 10.500 N Shcbp1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3959 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3959 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.