Transcript: Mouse NM_001324486.1

Mus musculus interleukin 10 receptor, alpha (Il10ra), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Il10ra (16154)
Length:
3503
CDS:
78..1799

Additional Resources:

NCBI RefSeq record:
NM_001324486.1
NBCI Gene record:
Il10ra (16154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001324486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067478 CCGCTTGGAATCCCGAATTAA pLKO.1 698 CDS 100% 15.000 21.000 N Il10ra n/a
2 TRCN0000067479 CCGAGTTTACAAGATTTCCAT pLKO.1 572 CDS 100% 3.000 4.200 N Il10ra n/a
3 TRCN0000067480 CCCTTGACAGATGCCTTTGAT pLKO.1 1464 CDS 100% 5.625 3.938 N Il10ra n/a
4 TRCN0000067481 CCACTGGAAACCTATCCCAAA pLKO.1 200 CDS 100% 4.050 2.835 N Il10ra n/a
5 TRCN0000067482 GCTACCAGAAACAGACCAGAT pLKO.1 1396 CDS 100% 4.050 2.835 N Il10ra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.