Transcript: Mouse NM_001326292.1

Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 (Adamts8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Adamts8 (30806)
Length:
4477
CDS:
1295..2857

Additional Resources:

NCBI RefSeq record:
NM_001326292.1
NBCI Gene record:
Adamts8 (30806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001326292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032096 CCCTTCAGTTATGGCTACAAT pLKO.1 2279 CDS 100% 5.625 7.875 N Adamts8 n/a
2 TRCN0000032094 GCAAAGGACTAGCAAAGCTAA pLKO.1 3156 3UTR 100% 4.950 6.930 N Adamts8 n/a
3 TRCN0000032098 GCTCGCTTCGTGGAAACACTT pLKO.1 972 5UTR 100% 4.950 6.930 N Adamts8 n/a
4 TRCN0000032097 CCGTGAATGTGATAATCCAAT pLKO.1 1837 CDS 100% 4.950 3.465 N Adamts8 n/a
5 TRCN0000032095 GCGTGCAGAATAGCAAGGAAA pLKO.1 2631 CDS 100% 4.950 3.465 N Adamts8 n/a
6 TRCN0000441318 AGCCCTGTGTGAGATTGTTTG pLKO_005 1314 CDS 100% 10.800 6.480 N Adamts8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001326292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.