Transcript: Human NM_001329101.1

Homo sapiens killer cell lectin like receptor G1 (KLRG1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
KLRG1 (10219)
Length:
1891
CDS:
349..681

Additional Resources:

NCBI RefSeq record:
NM_001329101.1
NBCI Gene record:
KLRG1 (10219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419423 GATCTGTCATGTATCCCTAAA pLKO_005 709 3UTR 100% 10.800 7.560 N KLRG1 n/a
2 TRCN0000419100 GATTGGTCTGAGGAACAATTC pLKO_005 507 CDS 100% 10.800 7.560 N KLRG1 n/a
3 TRCN0000057420 CCGCTGGATGAAATATGGTAA pLKO.1 342 5UTR 100% 4.950 3.465 N KLRG1 n/a
4 TRCN0000057418 GCCTAACTGATGGATTCTCTT pLKO.1 839 3UTR 100% 4.950 3.465 N KLRG1 n/a
5 TRCN0000057421 GTGTGTAAGAAGGTCAGACTT pLKO.1 658 CDS 100% 4.950 3.465 N KLRG1 n/a
6 TRCN0000057419 CCTCCTTGTGATAACGGACAA pLKO.1 438 CDS 100% 4.050 2.835 N KLRG1 n/a
7 TRCN0000057422 GCCTTCTTGTTCTTGCCTTGT pLKO.1 207 5UTR 100% 4.050 2.835 N KLRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.