Transcript: Human NM_001329868.2

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 5 (GALNT5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GALNT5 (11227)
Length:
10425
CDS:
1870..3282

Additional Resources:

NCBI RefSeq record:
NM_001329868.2
NBCI Gene record:
GALNT5 (11227)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036416 CCAGTAATCGAAGTCATCAAT pLKO.1 2302 CDS 100% 5.625 7.875 N GALNT5 n/a
2 TRCN0000435696 ACCTGGTTAAGACTTATTAAA pLKO_005 2998 CDS 100% 15.000 10.500 N GALNT5 n/a
3 TRCN0000423801 ATACAACCAGAGTCATATAAA pLKO_005 1590 5UTR 100% 15.000 10.500 N GALNT5 n/a
4 TRCN0000412505 CAATGTCTACCTTAGCGATTT pLKO_005 1770 5UTR 100% 10.800 7.560 N GALNT5 n/a
5 TRCN0000036418 CCCTTGTGATAACAGAAACAA pLKO.1 3072 CDS 100% 5.625 3.938 N GALNT5 n/a
6 TRCN0000036417 GCAGAGCAGCTAGTTCACAAT pLKO.1 1918 CDS 100% 4.950 3.465 N GALNT5 n/a
7 TRCN0000036415 GCATAAATCAACATCAGTCTT pLKO.1 3108 CDS 100% 4.950 3.465 N GALNT5 n/a
8 TRCN0000036414 CCTCTCATTCAGTGAGATCAA pLKO.1 480 5UTR 100% 0.495 0.347 N GALNT5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.