Transcript: Human NM_001330.3

Homo sapiens cardiotrophin 1 (CTF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CTF1 (1489)
Length:
1681
CDS:
38..643

Additional Resources:

NCBI RefSeq record:
NM_001330.3
NBCI Gene record:
CTF1 (1489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058572 GAGGCCAAGATCCGTCAGACA pLKO.1 107 CDS 100% 0.880 1.232 N CTF1 n/a
2 TRCN0000058568 GATTCCTCAGTCTCACTTCTT pLKO.1 77 CDS 100% 4.950 3.960 N CTF1 n/a
3 TRCN0000058571 CCCAGACTGATTCCTCAGTCT pLKO.1 69 CDS 100% 0.264 0.211 N CTF1 n/a
4 TRCN0000371943 GTCTCTCCTTCCGCTTCTTTG pLKO_005 686 3UTR 100% 10.800 7.560 N CTF1 n/a
5 TRCN0000371995 TCACCAAATACGCTGAGCAGC pLKO_005 147 CDS 100% 2.160 1.512 N CTF1 n/a
6 TRCN0000058570 CTTGCGCACCTCCTCACCAAA pLKO.1 134 CDS 100% 1.650 1.155 N CTF1 n/a
7 TRCN0000058569 GCTCCGCGTTTGCGGCCTCTA pLKO.1 559 CDS 100% 0.000 0.000 N CTF1 n/a
8 TRCN0000371942 GAGCAGCTGCTCCAGGAATAT pLKO_005 161 CDS 100% 13.200 7.920 N CTF1 n/a
9 TRCN0000371944 TGTCTGTCTGTCTGCTCTTAG pLKO_005 727 3UTR 100% 10.800 6.480 N CTF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.