Transcript: Mouse NM_001330160.1

Mus musculus integrin alpha 7 (Itga7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Itga7 (16404)
Length:
4047
CDS:
177..3599

Additional Resources:

NCBI RefSeq record:
NM_001330160.1
NBCI Gene record:
Itga7 (16404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001330160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066189 CCCGGAATCTACTATCTTATT pLKO.1 213 CDS 100% 13.200 18.480 N Itga7 n/a
2 TRCN0000437567 CGATTCTGGGAAGGGTCTTAT pLKO_005 989 CDS 100% 13.200 18.480 N Itga7 n/a
3 TRCN0000442150 AGGAGTACATGGCCGTGAAAT pLKO_005 3142 CDS 100% 13.200 9.240 N Itga7 n/a
4 TRCN0000413667 TCCATGTTTGGGATCAGTTTG pLKO_005 1323 CDS 100% 10.800 7.560 N Itga7 n/a
5 TRCN0000066191 CGAGCCAACATCACAGTGAAA pLKO.1 3180 CDS 100% 4.950 3.465 N Itga7 n/a
6 TRCN0000066190 CCCTACTTCTTTGAACGCCAA pLKO.1 1212 CDS 100% 2.160 1.512 N Itga7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.