Transcript: Human NM_001330246.2

Homo sapiens methionyl aminopeptidase 2 (METAP2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
METAP2 (10988)
Length:
3397
CDS:
29..1462

Additional Resources:

NCBI RefSeq record:
NM_001330246.2
NBCI Gene record:
METAP2 (10988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031798 CCTGTATCCTAATGGTGTATT pLKO.1 391 CDS 100% 13.200 18.480 N Metap2 n/a
2 TRCN0000306917 GACAAAGGCAAACCGTCTAAT pLKO_005 1606 3UTR 100% 13.200 18.480 N METAP2 n/a
3 TRCN0000294143 GGATCATATACAGCGCAATTT pLKO_005 1379 CDS 100% 13.200 18.480 N METAP2 n/a
4 TRCN0000050579 GCTGCCCATTATACTCCCAAT pLKO.1 710 CDS 100% 4.050 5.670 N METAP2 n/a
5 TRCN0000087607 CCAATATGTGACCTGTATCCT pLKO.1 380 CDS 100% 3.000 2.400 N LOC384679 n/a
6 TRCN0000294144 CCCAAATATGATACGTTATTA pLKO_005 836 CDS 100% 15.000 10.500 N METAP2 n/a
7 TRCN0000050580 CTTGGGAGAAAGTAAATACTT pLKO.1 1291 CDS 100% 5.625 3.938 N METAP2 n/a
8 TRCN0000050582 GCAACTGGAAAGAAGAAGAAA pLKO.1 308 CDS 100% 5.625 3.938 N METAP2 n/a
9 TRCN0000050581 GCAGAAGCACATCGACAAGTT pLKO.1 542 CDS 100% 4.950 3.465 N METAP2 n/a
10 TRCN0000286742 GCAGAAGCACATCGACAAGTT pLKO_005 542 CDS 100% 4.950 3.465 N METAP2 n/a
11 TRCN0000050578 CCAAAGGACAAGAATGCGAAT pLKO.1 414 CDS 100% 4.050 2.835 N METAP2 n/a
12 TRCN0000286743 CCAAAGGACAAGAATGCGAAT pLKO_005 414 CDS 100% 4.050 2.835 N METAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.