Transcript: Human NM_001330348.1

Homo sapiens TBC1 domain family member 8 (TBC1D8), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
TBC1D8 (11138)
Length:
4255
CDS:
195..3662

Additional Resources:

NCBI RefSeq record:
NM_001330348.1
NBCI Gene record:
TBC1D8 (11138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107062 GCTGCCTCGATATTATGTATA pLKO.1 2947 CDS 100% 13.200 18.480 N TBC1D8 n/a
2 TRCN0000299124 GCTGCCTCGATATTATGTATA pLKO_005 2947 CDS 100% 13.200 18.480 N TBC1D8 n/a
3 TRCN0000303439 TCCGAATCACCACGCAGAATA pLKO_005 898 CDS 100% 13.200 18.480 N TBC1D8 n/a
4 TRCN0000310697 GAACGTGCTTCGAGTCGTTAT pLKO_005 2639 CDS 100% 10.800 15.120 N TBC1D8 n/a
5 TRCN0000107060 CCGAGATTTCAGTCTACCTTA pLKO.1 3742 3UTR 100% 4.950 6.930 N TBC1D8 n/a
6 TRCN0000331121 CCGAGATTTCAGTCTACCTTA pLKO_005 3742 3UTR 100% 4.950 6.930 N TBC1D8 n/a
7 TRCN0000107064 CGAAACGGGAATTGCTGCTTT pLKO.1 1937 CDS 100% 4.950 6.930 N TBC1D8 n/a
8 TRCN0000299125 CGAAACGGGAATTGCTGCTTT pLKO_005 1937 CDS 100% 4.950 6.930 N TBC1D8 n/a
9 TRCN0000107063 CCTACCCTGTGACTGATATTT pLKO.1 2500 CDS 100% 15.000 10.500 N TBC1D8 n/a
10 TRCN0000107061 CCAATCACAATCTGAACTTAA pLKO.1 3626 CDS 100% 13.200 9.240 N TBC1D8 n/a
11 TRCN0000088319 GCAGGTTTCTAGATCACATTA pLKO.1 2413 CDS 100% 13.200 9.240 N Tbc1d8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.