Transcript: Mouse NM_001330363.1

Mus musculus potassium inwardly-rectifying channel, subfamily J, member 8 (Kcnj8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kcnj8 (16523)
Length:
2559
CDS:
501..1775

Additional Resources:

NCBI RefSeq record:
NM_001330363.1
NBCI Gene record:
Kcnj8 (16523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001330363.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069840 GCAACTGACCTTGCCAATCAA pLKO.1 1344 CDS 100% 5.625 7.875 N Kcnj8 n/a
2 TRCN0000069841 GCAGGACATTCCTGTTGATAA pLKO.1 1235 CDS 100% 13.200 9.240 N Kcnj8 n/a
3 TRCN0000069838 GCGTGTACTCTGTGGACTATT pLKO.1 1498 CDS 100% 13.200 9.240 N Kcnj8 n/a
4 TRCN0000308085 TGATCATCTGCCACGTGATTG pLKO_005 1294 CDS 100% 10.800 7.560 N KCNJ8 n/a
5 TRCN0000069839 CCTATTCATCAGCAGGACATT pLKO.1 1224 CDS 100% 4.950 3.465 N Kcnj8 n/a
6 TRCN0000069842 CATCTATGCTTACATGGAGAA pLKO.1 800 CDS 100% 4.050 2.835 N Kcnj8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330363.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.