Transcript: Human NM_001330433.2

Homo sapiens KIAA1841 (KIAA1841), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
KIAA1841 (84542)
Length:
3040
CDS:
304..2427

Additional Resources:

NCBI RefSeq record:
NM_001330433.2
NBCI Gene record:
KIAA1841 (84542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263317 GACAGATTTACATCGATATAT pLKO_005 2507 3UTR 100% 15.000 21.000 N KIAA1841 n/a
2 TRCN0000167296 CCATGCAACATGAACTGTATT pLKO.1 1087 CDS 100% 13.200 18.480 N KIAA1841 n/a
3 TRCN0000263318 CATGATCCTTTATCCATTAAT pLKO_005 366 CDS 100% 15.000 10.500 N KIAA1841 n/a
4 TRCN0000263319 ATGGGATGTTCATGAGTATTT pLKO_005 1401 CDS 100% 13.200 9.240 N KIAA1841 n/a
5 TRCN0000263320 GCCTGTTGACAACCAGTATAA pLKO_005 495 CDS 100% 13.200 9.240 N KIAA1841 n/a
6 TRCN0000282575 TCAAGGTGAAGGCGGAGATTT pLKO_005 1707 CDS 100% 13.200 9.240 N KIAA1841 n/a
7 TRCN0000167246 CCATGCATGTTGTTATACTTT pLKO.1 2821 3UTR 100% 5.625 3.938 N KIAA1841 n/a
8 TRCN0000167647 GCAAGTTCATTGAATACTGTT pLKO.1 1582 CDS 100% 4.950 3.465 N KIAA1841 n/a
9 TRCN0000179901 CCAAACATGGTGATCCATGTA pLKO.1 736 CDS 100% 0.495 0.297 N 0610010F05Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.