Transcript: Human NM_001330434.1

Homo sapiens KIAA1841 (KIAA1841), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
KIAA1841 (84542)
Length:
4438
CDS:
305..2308

Additional Resources:

NCBI RefSeq record:
NM_001330434.1
NBCI Gene record:
KIAA1841 (84542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167296 CCATGCAACATGAACTGTATT pLKO.1 1088 CDS 100% 13.200 18.480 N KIAA1841 n/a
2 TRCN0000263318 CATGATCCTTTATCCATTAAT pLKO_005 367 CDS 100% 15.000 10.500 N KIAA1841 n/a
3 TRCN0000263319 ATGGGATGTTCATGAGTATTT pLKO_005 1402 CDS 100% 13.200 9.240 N KIAA1841 n/a
4 TRCN0000263320 GCCTGTTGACAACCAGTATAA pLKO_005 496 CDS 100% 13.200 9.240 N KIAA1841 n/a
5 TRCN0000282575 TCAAGGTGAAGGCGGAGATTT pLKO_005 1555 CDS 100% 13.200 9.240 N KIAA1841 n/a
6 TRCN0000179901 CCAAACATGGTGATCCATGTA pLKO.1 737 CDS 100% 0.495 0.297 N 0610010F05Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.