Transcript: Human NM_001330643.1

Homo sapiens coiled-coil domain containing 149 (CCDC149), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
CCDC149 (91050)
Length:
4011
CDS:
100..1722

Additional Resources:

NCBI RefSeq record:
NM_001330643.1
NBCI Gene record:
CCDC149 (91050)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161685 GTTGGAAACAATCCACGAGAA pLKO.1 1008 CDS 100% 4.050 5.670 N CCDC149 n/a
2 TRCN0000160714 CAGGCTAATCTTGCACAACTA pLKO.1 361 CDS 100% 4.950 3.960 N CCDC149 n/a
3 TRCN0000159539 CAACCTCTTGAAATCAAACAT pLKO.1 801 CDS 100% 5.625 3.938 N CCDC149 n/a
4 TRCN0000164290 CCTGTCTGCAAAGCAAGTTCA pLKO.1 903 CDS 100% 4.950 3.465 N CCDC149 n/a
5 TRCN0000137460 GAGCGAGCTAAGGAACAGATT pLKO.1 571 CDS 100% 4.950 3.465 N CCDC149 n/a
6 TRCN0000136802 CGAGAGCTGATTGATGGAGAT pLKO.1 313 CDS 100% 4.050 2.835 N CCDC149 n/a
7 TRCN0000163468 GAGAGATTCTCAGGACCGAAA pLKO.1 384 CDS 100% 4.050 2.835 N CCDC149 n/a
8 TRCN0000163292 GCAACTCCATGAAGAGGTCAA pLKO.1 783 CDS 100% 4.050 2.835 N CCDC149 n/a
9 TRCN0000134003 CCTTCAAGAGAGATTAAAGCA pLKO.1 765 CDS 100% 3.000 1.800 N CCDC149 n/a
10 TRCN0000163877 CTGACCTGAAATCTCTGGCAA pLKO.1 980 CDS 100% 2.640 1.584 N CCDC149 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.