Transcript: Human NM_001330751.2

Homo sapiens PPARG coactivator 1 alpha (PPARGC1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PPARGC1A (10891)
Length:
6908
CDS:
696..3107

Additional Resources:

NCBI RefSeq record:
NM_001330751.2
NBCI Gene record:
PPARGC1A (10891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364084 GACTATTGCCAGTCAATTAAT pLKO_005 1863 CDS 100% 15.000 21.000 N PPARGC1A n/a
2 TRCN0000364085 TATGACAGCTACGAGGAATAT pLKO_005 2610 CDS 100% 13.200 18.480 N PPARGC1A n/a
3 TRCN0000001166 CCGTTATACCTGTGATGCTTT pLKO.1 2876 CDS 100% 4.950 6.930 N PPARGC1A n/a
4 TRCN0000001165 GCAGAGTATGACGATGGTATT pLKO.1 4881 3UTR 100% 10.800 8.640 N PPARGC1A n/a
5 TRCN0000001168 CGACTTGGATACAGACAGCTT pLKO.1 842 CDS 100% 2.640 2.112 N PPARGC1A n/a
6 TRCN0000364087 TTCCATGAAGACACGCTTAAA pLKO_005 3538 3UTR 100% 13.200 9.240 N PPARGC1A n/a
7 TRCN0000364086 TCGTGTTCCCGATCACCATAT pLKO_005 2439 CDS 100% 10.800 7.560 N PPARGC1A n/a
8 TRCN0000095313 CCCATTTGAGAACAAGACTAT pLKO.1 1529 CDS 100% 4.950 3.465 N Ppargc1a n/a
9 TRCN0000001169 GACAGCGAAGATGAAAGTGAT pLKO.1 2247 CDS 100% 4.950 3.465 N PPARGC1A n/a
10 TRCN0000001167 CCTCCTCATAAAGCCAACCAA pLKO.1 1608 CDS 100% 3.000 2.100 N PPARGC1A n/a
11 TRCN0000219080 TAACTATGCAGACCTAGATAC pLKO_005 2987 CDS 100% 10.800 7.560 N Ppargc1a n/a
12 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 3664 3UTR 100% 4.950 2.475 Y HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.