Transcript: Human NM_001330770.2

Homo sapiens connector enhancer of kinase suppressor of Ras 2 (CNKSR2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CNKSR2 (22866)
Length:
5606
CDS:
481..3438

Additional Resources:

NCBI RefSeq record:
NM_001330770.2
NBCI Gene record:
CNKSR2 (22866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362681 TCCTCCTGCAGAACCATATAT pLKO_005 1398 CDS 100% 15.000 12.000 N Cnksr2 n/a
2 TRCN0000077894 GCAGCAGTATATTAAGAACTT pLKO.1 561 CDS 100% 4.950 3.960 N CNKSR2 n/a
3 TRCN0000077896 GCAAACATTAAACCAAGCGAA pLKO.1 1135 CDS 100% 2.640 2.112 N CNKSR2 n/a
4 TRCN0000425742 ATGGAATACAAGCTATCATTT pLKO_005 3130 CDS 100% 13.200 9.240 N CNKSR2 n/a
5 TRCN0000415659 CACTAGGAGAACATCGTATTT pLKO_005 3101 CDS 100% 13.200 9.240 N CNKSR2 n/a
6 TRCN0000414531 GAAGTAGCCATTATCGATAAA pLKO_005 3235 CDS 100% 13.200 9.240 N CNKSR2 n/a
7 TRCN0000077895 GCGATGAAGTGATTCAAGTTA pLKO.1 1256 CDS 100% 5.625 3.938 N CNKSR2 n/a
8 TRCN0000077893 CCAGTGCATAAGGGATCTGAA pLKO.1 1480 CDS 100% 4.950 3.465 N CNKSR2 n/a
9 TRCN0000077897 CCACTGACAAGTTCAGGCTTA pLKO.1 2656 CDS 100% 4.050 2.835 N CNKSR2 n/a
10 TRCN0000025053 CCTATATCTATGCCAGTGGAA pLKO.1 1648 CDS 100% 2.640 1.848 N Cnksr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.