Transcript: Mouse NM_001331064.1

Mus musculus abhydrolase domain containing 6 (Abhd6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Abhd6 (66082)
Length:
2310
CDS:
174..1184

Additional Resources:

NCBI RefSeq record:
NM_001331064.1
NBCI Gene record:
Abhd6 (66082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032796 CAGCACTGATAAGAATCTATT pLKO.1 268 CDS 100% 13.200 18.480 N Abhd6 n/a
2 TRCN0000032798 CAGACATATTAGCCAAGTCAA pLKO.1 1030 CDS 100% 4.950 6.930 N Abhd6 n/a
3 TRCN0000032797 CCTGCAGTACTCAACTGACAA pLKO.1 698 CDS 100% 4.950 3.960 N Abhd6 n/a
4 TRCN0000375660 AGACATTCCTCATACATTAAA pLKO_005 1535 3UTR 100% 15.000 10.500 N Abhd6 n/a
5 TRCN0000348838 CTACAGGAGCTTTAGTCATTT pLKO_005 1619 3UTR 100% 13.200 9.240 N Abhd6 n/a
6 TRCN0000348900 ACGCACACCATGAGGACTATC pLKO_005 328 CDS 100% 10.800 7.560 N Abhd6 n/a
7 TRCN0000364037 CACAAGCCATCCATCCTTATG pLKO_005 381 CDS 100% 10.800 7.560 N Abhd6 n/a
8 TRCN0000375661 GATACATCAGTTTGTAGAATG pLKO_005 554 CDS 100% 10.800 7.560 N Abhd6 n/a
9 TRCN0000032794 GCCATTCCAATCCTGGCATTT pLKO.1 222 CDS 100% 10.800 7.560 N Abhd6 n/a
10 TRCN0000352181 GCCATTCCAATCCTGGCATTT pLKO_005 222 CDS 100% 10.800 7.560 N Abhd6 n/a
11 TRCN0000032795 GCATGAGAATATGGACAAGAT pLKO.1 950 CDS 100% 4.950 3.465 N Abhd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.