Transcript: Human NM_001345975.2

Homo sapiens YTH domain containing 2 (YTHDC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
YTHDC2 (64848)
Length:
6108
CDS:
492..4298

Additional Resources:

NCBI RefSeq record:
NM_001345975.2
NBCI Gene record:
YTHDC2 (64848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001345975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232757 ATGCTGGTGCAGTACTAATTT pLKO_005 1867 CDS 100% 15.000 21.000 N YTHDC2 n/a
2 TRCN0000154178 CCCTCGTCACATCTCTTATAT pLKO.1 5085 3UTR 100% 15.000 21.000 N YTHDC2 n/a
3 TRCN0000152850 GCCCACAGATTGGCTTATTTA pLKO.1 3095 CDS 100% 15.000 21.000 N YTHDC2 n/a
4 TRCN0000157638 CGGAAGCTAAATCGAGCCTTT pLKO.1 3957 CDS 100% 4.050 5.670 N YTHDC2 n/a
5 TRCN0000232759 CAGAAGTGGCATAGCTTATTT pLKO_005 3387 CDS 100% 15.000 10.500 N YTHDC2 n/a
6 TRCN0000232758 GCCCATAGAATAGCTAATATT pLKO_005 3132 CDS 100% 15.000 10.500 N YTHDC2 n/a
7 TRCN0000232760 GCTACCATAAGAGCAATTATA pLKO_005 3456 CDS 100% 15.000 10.500 N YTHDC2 n/a
8 TRCN0000232761 TGCCTATAGTTCTAGTTATTA pLKO_005 5743 3UTR 100% 15.000 10.500 N YTHDC2 n/a
9 TRCN0000152454 CCTCATCTTGGAGGTCAAATA pLKO.1 3574 CDS 100% 13.200 9.240 N YTHDC2 n/a
10 TRCN0000150929 GCCTTGGATGTAAATCTCTTT pLKO.1 1053 CDS 100% 4.950 3.465 N YTHDC2 n/a
11 TRCN0000153318 GCTCAGGTCTTTCATCTCATT pLKO.1 1461 CDS 100% 4.950 3.465 N YTHDC2 n/a
12 TRCN0000158315 CCAAGACCAAACATGCCTGTT pLKO.1 3849 CDS 100% 4.050 2.835 N YTHDC2 n/a
13 TRCN0000153934 CCTTCTACTTTCTCTGGGAAA pLKO.1 5678 3UTR 100% 4.050 2.835 N YTHDC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001345975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.