Transcript: Human NM_001346027.2

Homo sapiens ubiquitin specific peptidase 45 (USP45), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-26
Taxon:
Homo sapiens (human)
Gene:
USP45 (85015)
Length:
5942
CDS:
1168..2532

Additional Resources:

NCBI RefSeq record:
NM_001346027.2
NBCI Gene record:
USP45 (85015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346027.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253809 ATCTGAGCACATGGATTATAT pLKO_005 398 5UTR 100% 15.000 10.500 N USP45 n/a
2 TRCN0000253808 TGTAGTTCCCTGGTCATATTT pLKO_005 3172 3UTR 100% 15.000 10.500 N USP45 n/a
3 TRCN0000253806 CTGTTCCAGCTGTCCTAATTC pLKO_005 2117 CDS 100% 13.200 9.240 N USP45 n/a
4 TRCN0000030892 GCTTGAGTCTTCGTAAAGTAA pLKO.1 2165 CDS 100% 5.625 3.938 N Usp45 n/a
5 TRCN0000317980 GCTTGAGTCTTCGTAAAGTAA pLKO_005 2165 CDS 100% 5.625 3.938 N Usp45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346027.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.