Transcript: Mouse NM_001346957.1

Mus musculus neurexin I (Nrxn1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nrxn1 (18189)
Length:
8695
CDS:
880..5262

Additional Resources:

NCBI RefSeq record:
NM_001346957.1
NBCI Gene record:
Nrxn1 (18189)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094628 GAAGAGTCTAATGCAATCATT pLKO.1 4429 CDS 100% 5.625 3.938 N Nrxn1 n/a
2 TRCN0000094626 GCTGGCTATAACCTCAATGAT pLKO.1 3226 CDS 100% 5.625 3.938 N Nrxn1 n/a
3 TRCN0000094624 CAAGATTTGAAACGGACACTT pLKO.1 5266 3UTR 100% 4.950 3.465 N Nrxn1 n/a
4 TRCN0000203688 CGCACGCATTCATAAAGCAAA pLKO.1 5611 3UTR 100% 4.950 3.465 N NRXN1 n/a
5 TRCN0000094625 CGTGTGAAACTCACGGTCAAT pLKO.1 3178 CDS 100% 4.950 3.465 N Nrxn1 n/a
6 TRCN0000094627 GCTGCACATACACCAAGGAAA pLKO.1 4365 CDS 100% 4.950 2.970 N Nrxn1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6581 3UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000204076 GCTACCTATGATCCTGGATTT pLKO.1 5690 3UTR 100% 10.800 8.640 N NRXN1 n/a
9 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 6585 3UTR 100% 15.000 7.500 Y KAAG1 n/a
10 TRCN0000178741 CACACACATACACACACACAA pLKO.1 6557 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.