Transcript: Mouse NM_001347036.1

Mus musculus low density lipoprotein-related protein 12 (Lrp12), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lrp12 (239393)
Length:
4245
CDS:
313..2832

Additional Resources:

NCBI RefSeq record:
NM_001347036.1
NBCI Gene record:
Lrp12 (239393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323160 ATGTTAGCCTGCATGGTTAAA pLKO_005 2948 3UTR 100% 13.200 9.240 N LRP12 n/a
2 TRCN0000086665 CGGACAGATAAGAGTACATTT pLKO.1 1296 CDS 100% 13.200 9.240 N Lrp12 n/a
3 TRCN0000086664 CCGGACAGATAAGAGTACATT pLKO.1 1295 CDS 100% 5.625 3.938 N Lrp12 n/a
4 TRCN0000086663 CGGATGAAGATTCTCTACTAT pLKO.1 3549 3UTR 100% 5.625 3.938 N Lrp12 n/a
5 TRCN0000086667 CCTGAGTCCTTAAAGTGTGAT pLKO.1 955 CDS 100% 4.950 3.465 N Lrp12 n/a
6 TRCN0000086666 GCCAGGGAATTTCCACTGTAA pLKO.1 1611 CDS 100% 4.950 3.465 N Lrp12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.