Transcript: Mouse NM_001347186.1

Mus musculus SLAM family member 6 (Slamf6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Slamf6 (30925)
Length:
1570
CDS:
247..1302

Additional Resources:

NCBI RefSeq record:
NM_001347186.1
NBCI Gene record:
Slamf6 (30925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039094 CCTCGTTATCAACCTAAGTAA pLKO.1 480 CDS 100% 5.625 7.875 N Slamf6 n/a
2 TRCN0000039096 GCATACATGTTTGGAAGAGAA pLKO.1 1028 CDS 100% 4.950 3.960 N Slamf6 n/a
3 TRCN0000039098 CAGCTAATGAATGGCGTTCTA pLKO.1 364 CDS 100% 4.950 3.465 N Slamf6 n/a
4 TRCN0000039097 CCCTGCAAATCAGCAACCTTA pLKO.1 566 CDS 100% 4.950 3.465 N Slamf6 n/a
5 TRCN0000039095 GCAATTTGTCAGTCTCTGTTT pLKO.1 896 CDS 100% 4.950 3.465 N Slamf6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.