Transcript: Mouse NM_001347235.1

Mus musculus SPEN homolog, transcriptional regulator (Drosophila) (Spen), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Spen (56381)
Length:
12230
CDS:
352..11214

Additional Resources:

NCBI RefSeq record:
NM_001347235.1
NBCI Gene record:
Spen (56381)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226288 AGTGAGAGACGATCCATTAAA pLKO_005 4233 CDS 100% 15.000 21.000 N Spen n/a
2 TRCN0000226286 GACCTCCGCACGGATTATAAT pLKO_005 568 CDS 100% 15.000 21.000 N Spen n/a
3 TRCN0000226287 ATTACGATCAGGATTACTATA pLKO_005 842 CDS 100% 13.200 18.480 N Spen n/a
4 TRCN0000232713 ATTACGATCAGGATTACTATA pLKO_005 842 CDS 100% 13.200 18.480 N SPEN n/a
5 TRCN0000086089 CGTCTCGTAGTAGAGAGGTTT pLKO.1 644 CDS 100% 4.950 6.930 N Spen n/a
6 TRCN0000086091 CCTTGGAAATAACCGCCTCAA pLKO.1 1857 CDS 100% 4.050 3.240 N Spen n/a
7 TRCN0000218154 GAACAGCCTTTGCACTAAATT pLKO_005 11528 3UTR 100% 15.000 10.500 N Spen n/a
8 TRCN0000218526 ACTTTGTACCGTCACTCATTT pLKO_005 11995 3UTR 100% 13.200 9.240 N Spen n/a
9 TRCN0000075165 CCTGTGGTAAAGGTGGTGTTT pLKO.1 1981 CDS 100% 4.950 3.465 N SPEN n/a
10 TRCN0000086090 GCCATTGTTTGTCCCTGCAAA pLKO.1 10584 CDS 100% 4.950 3.465 N Spen n/a
11 TRCN0000086092 GCTAGCTCTTTAGAAAGGAAT pLKO.1 4597 CDS 100% 4.950 3.465 N Spen n/a
12 TRCN0000086088 GCAGAAGATCACGTTGGCAAA pLKO.1 8172 CDS 100% 4.050 2.835 N Spen n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.