Transcript: Mouse NM_001347309.1

Mus musculus tumor necrosis factor (ligand) superfamily, member 13b (Tnfsf13b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tnfsf13b (24099)
Length:
1808
CDS:
377..1249

Additional Resources:

NCBI RefSeq record:
NM_001347309.1
NBCI Gene record:
Tnfsf13b (24099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379369 ACGCTAAGTCTCAGGATTTAC pLKO_005 1620 3UTR 100% 13.200 18.480 N Tnfsf13b n/a
2 TRCN0000066370 CTCGGGAGAATGCACAGATTT pLKO.1 1182 CDS 100% 13.200 18.480 N Tnfsf13b n/a
3 TRCN0000363413 GTGACCCTGTTCCGATGTATT pLKO_005 1070 CDS 100% 13.200 18.480 N Tnfsf13b n/a
4 TRCN0000363478 TTTCTCGTGACCCGTTGAATC pLKO_005 1357 3UTR 100% 10.800 15.120 N Tnfsf13b n/a
5 TRCN0000066372 CCACAGGAACAGACGCGCTTT pLKO.1 739 CDS 100% 1.350 1.890 N Tnfsf13b n/a
6 TRCN0000066371 GTTCCGATGTATTCAGAATAT pLKO.1 1078 CDS 100% 13.200 10.560 N Tnfsf13b n/a
7 TRCN0000066368 GCCATTCTCAACATGATGATA pLKO.1 831 CDS 100% 5.625 3.938 N Tnfsf13b n/a
8 TRCN0000066369 GCTCCGAGAAAGGAGAAGATA pLKO.1 423 CDS 100% 5.625 3.938 N Tnfsf13b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.