Transcript: Mouse NM_001347356.1

Mus musculus TatD DNase domain containing 2 (Tatdn2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tatdn2 (381801)
Length:
3292
CDS:
559..2910

Additional Resources:

NCBI RefSeq record:
NM_001347356.1
NBCI Gene record:
Tatdn2 (381801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217321 GAAGGAAGCTTGTAGCGTTAA pLKO.1 942 CDS 100% 10.800 15.120 N Tatdn2 n/a
2 TRCN0000200217 CAAGATCCATAGGCACTGCTT pLKO.1 2574 CDS 100% 2.640 3.696 N Tatdn2 n/a
3 TRCN0000177573 CAAAGGTTACAGTTACTGTTT pLKO.1 1355 CDS 100% 4.950 3.465 N Tatdn2 n/a
4 TRCN0000200018 CCTCATCACAAGGCTTCACTT pLKO.1 3053 3UTR 100% 4.950 3.465 N Tatdn2 n/a
5 TRCN0000182723 GCTCTACTCCAAGCTGTCTTT pLKO.1 2136 CDS 100% 4.950 3.465 N Tatdn2 n/a
6 TRCN0000182724 GATGTTACCTTGGACCCTCAT pLKO.1 3038 3UTR 100% 4.050 2.835 N Tatdn2 n/a
7 TRCN0000176882 GCTGATGAAGATTTGTTGGAT pLKO.1 2524 CDS 100% 3.000 2.100 N Tatdn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.