Transcript: Mouse NM_001347358.1

Mus musculus replication factor C (activator 1) 1 (Rfc1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rfc1 (19687)
Length:
4717
CDS:
114..3506

Additional Resources:

NCBI RefSeq record:
NM_001347358.1
NBCI Gene record:
Rfc1 (19687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111300 CCGAGTATTCTTGGTGTATTA pLKO.1 3982 3UTR 100% 13.200 18.480 N Rfc1 n/a
2 TRCN0000111301 GCCCTAATAAAGCCGAGCTTT pLKO.1 910 CDS 100% 4.950 3.960 N Rfc1 n/a
3 TRCN0000111304 GCGCACTAATTATCAAGCTTA pLKO.1 1229 CDS 100% 4.950 3.960 N Rfc1 n/a
4 TRCN0000022037 CCTCCAGCTATGAATGAAATA pLKO.1 2451 CDS 100% 13.200 9.240 N RFC1 n/a
5 TRCN0000022038 CGCACTAATTATCAAGCTTAT pLKO.1 1230 CDS 100% 10.800 7.560 N RFC1 n/a
6 TRCN0000111302 CGGAGTAAGAACAGTTTGAAA pLKO.1 2103 CDS 100% 5.625 3.938 N Rfc1 n/a
7 TRCN0000111303 CGAGACAGTAAAGAATGAGAA pLKO.1 167 CDS 100% 4.950 3.465 N Rfc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.