Transcript: Mouse NM_001347489.1

Mus musculus microsomal glutathione S-transferase 1 (Mgst1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mgst1 (56615)
Length:
1165
CDS:
99..788

Additional Resources:

NCBI RefSeq record:
NM_001347489.1
NBCI Gene record:
Mgst1 (56615)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103397 CTATGGAGTTACTTTGTCAAT pLKO.1 731 CDS 100% 4.950 6.930 N Mgst1 n/a
2 TRCN0000302880 CTATGGAGTTACTTTGTCAAT pLKO_005 731 CDS 100% 4.950 6.930 N Mgst1 n/a
3 TRCN0000103395 GCGTGAAAGGAGCAGAGAAAT pLKO.1 881 3UTR 100% 13.200 9.240 N Mgst1 n/a
4 TRCN0000302879 GCGTGAAAGGAGCAGAGAAAT pLKO_005 881 3UTR 100% 13.200 9.240 N Mgst1 n/a
5 TRCN0000103396 CCCACCTGAATGATCTTGAAA pLKO.1 544 CDS 100% 5.625 3.938 N Mgst1 n/a
6 TRCN0000302878 CCCACCTGAATGATCTTGAAA pLKO_005 544 CDS 100% 5.625 3.938 N Mgst1 n/a
7 TRCN0000103399 CCTCATGCACTTCAGAATCTT pLKO.1 629 CDS 100% 5.625 3.938 N Mgst1 n/a
8 TRCN0000302963 CCTCATGCACTTCAGAATCTT pLKO_005 629 CDS 100% 5.625 3.938 N Mgst1 n/a
9 TRCN0000103398 CGCATTCCAGAGGATAACCAA pLKO.1 422 CDS 100% 3.000 2.100 N Mgst1 n/a
10 TRCN0000302881 CGCATTCCAGAGGATAACCAA pLKO_005 422 CDS 100% 3.000 2.100 N Mgst1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.