Transcript: Mouse NM_001347500.1

Mus musculus unc-5 netrin receptor D (Unc5d), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Unc5d (210801)
Length:
8998
CDS:
299..2947

Additional Resources:

NCBI RefSeq record:
NM_001347500.1
NBCI Gene record:
Unc5d (210801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071912 GACGCTTAGTAATGCCAAATA pLKO.1 1743 CDS 100% 13.200 18.480 N Unc5d n/a
2 TRCN0000071909 CGCGGATTCAGTACAATACAT pLKO.1 1631 CDS 100% 5.625 7.875 N Unc5d n/a
3 TRCN0000061321 CGCATAGCCTATTTACGGAAA pLKO.1 749 CDS 100% 4.050 5.670 N UNC5D n/a
4 TRCN0000071911 GAACAGCATCAATAGGAATTT pLKO.1 2728 CDS 100% 13.200 9.240 N Unc5d n/a
5 TRCN0000071910 GCTGTCAGACTCAGGGAATTA pLKO.1 958 CDS 100% 13.200 9.240 N Unc5d n/a
6 TRCN0000071908 GCACTGGAACATTCACCTGAA pLKO.1 1972 CDS 100% 4.050 2.835 N Unc5d n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4271 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.