Transcript: Mouse NM_001347502.1

Mus musculus coiled-coil serine rich 2 (Ccser2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ccser2 (72972)
Length:
7192
CDS:
40..3156

Additional Resources:

NCBI RefSeq record:
NM_001347502.1
NBCI Gene record:
Ccser2 (72972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000335991 GTGTGGCCTCTAATCGATATT pLKO_005 3107 CDS 100% 13.200 18.480 N Ccser2 n/a
2 TRCN0000179314 GCCATCCAACTTGAGTTCTTT pLKO.1 2790 CDS 100% 5.625 4.500 N Ccser2 n/a
3 TRCN0000335990 GCCATCCAACTTGAGTTCTTT pLKO_005 2790 CDS 100% 5.625 4.500 N Ccser2 n/a
4 TRCN0000184658 GCATGACGGAAGTGGATCATT pLKO.1 2100 CDS 100% 5.625 3.938 N Ccser2 n/a
5 TRCN0000335989 GCATGACGGAAGTGGATCATT pLKO_005 2100 CDS 100% 5.625 3.938 N Ccser2 n/a
6 TRCN0000183598 GCTCAGAAGATGTTTGTAGAT pLKO.1 1972 CDS 100% 4.950 3.465 N Ccser2 n/a
7 TRCN0000335988 GCTCAGAAGATGTTTGTAGAT pLKO_005 1972 CDS 100% 4.950 3.465 N Ccser2 n/a
8 TRCN0000195994 CAGGAATCACACCATGCCATT pLKO.1 2870 CDS 100% 4.050 2.835 N Ccser2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.