Transcript: Mouse NM_001347632.1

Mus musculus deleted in malignant brain tumors 1 (Dmbt1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Dmbt1 (12945)
Length:
6276
CDS:
10..5883

Additional Resources:

NCBI RefSeq record:
NM_001347632.1
NBCI Gene record:
Dmbt1 (12945)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413511 GTTGACTACAACTCCTTATTT pLKO_005 2640 CDS 100% 15.000 21.000 N Dmbt1 n/a
2 TRCN0000431686 AGTATGTCGAGCGTATGATAC pLKO_005 5568 CDS 100% 10.800 15.120 N Dmbt1 n/a
3 TRCN0000416784 GTATGGCAATTTCGACGTAAA pLKO_005 5226 CDS 100% 10.800 15.120 N Dmbt1 n/a
4 TRCN0000437901 TTGTACCTTCAGGCCGAAATC pLKO_005 5323 CDS 100% 10.800 15.120 N Dmbt1 n/a
5 TRCN0000089170 CCCTTCAAACTATCCAAACAA pLKO.1 2742 CDS 100% 5.625 7.313 N Dmbt1 n/a
6 TRCN0000089171 CCCTTCAAACTATCCTAACAA pLKO.1 3090 CDS 100% 5.625 7.313 N Dmbt1 n/a
7 TRCN0000433151 GGCTGCAACTATGACTATATC pLKO_005 2842 CDS 100% 13.200 9.240 N Dmbt1 n/a
8 TRCN0000089172 CGTTCCTGATTATACACCAAT pLKO.1 1386 CDS 100% 4.950 3.465 N Dmbt1 n/a
9 TRCN0000089169 CCTGGGAATTATCCTAATAAT pLKO.1 4573 CDS 100% 1.500 1.050 N Dmbt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.