Transcript: Human NM_001347708.2

Homo sapiens cholinergic receptor nicotinic alpha 2 subunit (CHRNA2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CHRNA2 (1135)
Length:
3904
CDS:
1036..2031

Additional Resources:

NCBI RefSeq record:
NM_001347708.2
NBCI Gene record:
CHRNA2 (1135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347708.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436304 CCATCCAGCTTAACGTTATTG pLKO_005 2176 3UTR 100% 13.200 18.480 N CHRNA2 n/a
2 TRCN0000061046 GCCCAACACTTCAGACGTGGT pLKO.1 805 5UTR 100% 0.720 1.008 N CHRNA2 n/a
3 TRCN0000445085 AGGAGTGGAGCGACTACAAAC pLKO_005 912 5UTR 100% 10.800 7.560 N CHRNA2 n/a
4 TRCN0000061044 CGTTCCTAGCTGGAATGATCT pLKO.1 2009 CDS 100% 4.950 3.465 N CHRNA2 n/a
5 TRCN0000438470 ATCGCTCAGCTCATCGATGTG pLKO_005 848 5UTR 100% 4.050 2.835 N CHRNA2 n/a
6 TRCN0000414672 CTAAGTGACAGAAGGGTCAAC pLKO_005 2333 3UTR 100% 4.050 2.835 N CHRNA2 n/a
7 TRCN0000061047 CAACATCACATCTCTCAGGGT pLKO.1 958 5UTR 100% 0.660 0.462 N CHRNA2 n/a
8 TRCN0000061045 CTGGAAGGTGTGCACTACATT pLKO.1 1849 CDS 100% 5.625 3.375 N CHRNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347708.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.