Transcript: Human NM_001347839.1

Homo sapiens AT-rich interaction domain 2 (ARID2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ARID2 (196528)
Length:
5703
CDS:
129..5495

Additional Resources:

NCBI RefSeq record:
NM_001347839.1
NBCI Gene record:
ARID2 (196528)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160691 CGGATTATCTGCGTCAAAGTT pLKO.1 544 CDS 100% 5.625 7.875 N ARID2 n/a
2 TRCN0000161920 GCAGGATAAGCACTGTTCAAA pLKO.1 5186 CDS 100% 5.625 7.875 N ARID2 n/a
3 TRCN0000166264 CGTACCTGTCTTCGTTTCCTA pLKO.1 1056 CDS 100% 3.000 4.200 N ARID2 n/a
4 TRCN0000218090 GACTAACAGCTGCCTTAATAT pLKO_005 5434 CDS 100% 15.000 10.500 N Arid2 n/a
5 TRCN0000166359 CCGACTAACAGCTGCCTTAAT pLKO.1 5432 CDS 100% 13.200 9.240 N ARID2 n/a
6 TRCN0000158944 GAATTTCTAATGGACCTGTAT pLKO.1 4369 CDS 100% 4.950 3.465 N ARID2 n/a
7 TRCN0000166321 CCTCCTTCAAACTCAGGGAAA pLKO.1 4041 CDS 100% 4.050 2.835 N ARID2 n/a
8 TRCN0000159797 GTTCTGTTGTTCAGAATCATA pLKO.1 2350 CDS 100% 0.563 0.394 N ARID2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.