Transcript: Human NM_001347966.2

Homo sapiens ecto-NOX disulfide-thiol exchanger 1 (ENOX1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ENOX1 (55068)
Length:
3506
CDS:
715..2646

Additional Resources:

NCBI RefSeq record:
NM_001347966.2
NBCI Gene record:
ENOX1 (55068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365076 TTGAACAGTGCGGTGATATTA pLKO_005 1199 CDS 100% 15.000 21.000 N ENOX1 n/a
2 TRCN0000370065 CCATACACAAGCGTTACTAAA pLKO_005 2232 CDS 100% 13.200 18.480 N ENOX1 n/a
3 TRCN0000365075 ACCGTGTTTGTCGGAGGATTA pLKO_005 1141 CDS 100% 10.800 15.120 N ENOX1 n/a
4 TRCN0000130610 CCACAGTCATAATGATGGCAA pLKO.1 2890 3UTR 100% 2.640 3.696 N ENOX1 n/a
5 TRCN0000148027 GCTCTGCTAATAGGTATCATA pLKO.1 2416 CDS 100% 5.625 4.500 N ENOX1 n/a
6 TRCN0000146363 CCAGGAGGAGTTAAACAACAA pLKO.1 2175 CDS 100% 4.950 3.960 N ENOX1 n/a
7 TRCN0000248603 TGTGCCTTTGAAGGAATTAAA pLKO_005 2617 CDS 100% 15.000 10.500 N Enox1 n/a
8 TRCN0000248602 AGCGCAAGAACATAGACATTT pLKO_005 1820 CDS 100% 13.200 9.240 N Enox1 n/a
9 TRCN0000365113 AGCGCAAGAACATAGACATTT pLKO_005 1820 CDS 100% 13.200 9.240 N ENOX1 n/a
10 TRCN0000370066 CACAGCCATGAGGATTCAAAT pLKO_005 2305 CDS 100% 13.200 9.240 N ENOX1 n/a
11 TRCN0000377431 TCGAAGCCTGCCTTTAGTTAT pLKO_005 2759 3UTR 100% 13.200 9.240 N ENOX1 n/a
12 TRCN0000130565 CAGCGCAAGAACATAGACATT pLKO.1 1819 CDS 100% 4.950 3.465 N ENOX1 n/a
13 TRCN0000129304 CCAGCGCAAGAACATAGACAT pLKO.1 1818 CDS 100% 4.950 3.465 N ENOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.