Transcript: Human NM_001348003.2

Homo sapiens NLR family pyrin domain containing 2 (NLRP2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NLRP2 (55655)
Length:
3531
CDS:
112..3291

Additional Resources:

NCBI RefSeq record:
NM_001348003.2
NBCI Gene record:
NLRP2 (55655)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129801 CTCAGGGATAATGAGTTCATT pLKO.1 3383 3UTR 100% 5.625 3.938 N NLRP2 n/a
2 TRCN0000280690 CTCAGGGATAATGAGTTCATT pLKO_005 3383 3UTR 100% 5.625 3.938 N NLRP2 n/a
3 TRCN0000130989 CCAGGTTATGGCTGAGAGATA pLKO.1 648 CDS 100% 4.950 3.465 N NLRP2 n/a
4 TRCN0000280624 CCAGGTTATGGCTGAGAGATA pLKO_005 648 CDS 100% 4.950 3.465 N NLRP2 n/a
5 TRCN0000128546 GCAGGTAATAAAGGAGAATCT pLKO.1 2067 CDS 100% 4.950 3.465 N NLRP2 n/a
6 TRCN0000280689 GCAGGTAATAAAGGAGAATCT pLKO_005 2067 CDS 100% 4.950 3.465 N NLRP2 n/a
7 TRCN0000128382 GAGTCATTCATTCTCCATGAA pLKO.1 3300 3UTR 100% 0.495 0.347 N NLRP2 n/a
8 TRCN0000128236 GCTGAATCACATAGGAGTTAA pLKO.1 2901 CDS 100% 13.200 7.920 N NLRP2 n/a
9 TRCN0000280688 GCTGAATCACATAGGAGTTAA pLKO_005 2901 CDS 100% 13.200 7.920 N NLRP2 n/a
10 TRCN0000127655 CTCAATAAGCTGCTGGAAGAA pLKO.1 3181 CDS 100% 4.950 2.970 N NLRP2 n/a
11 TRCN0000130061 GAAGATGCTGTTTGAAACCTT pLKO.1 3099 CDS 100% 3.000 1.800 N NLRP2 n/a
12 TRCN0000280691 GAAGATGCTGTTTGAAACCTT pLKO_005 3099 CDS 100% 3.000 1.800 N NLRP2 n/a
13 TRCN0000130867 GAACTCAATAAGCTGCTGGAA pLKO.1 3178 CDS 100% 2.640 1.584 N NLRP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.