Transcript: Human NM_001348082.2

Homo sapiens DLC1 Rho GTPase activating protein (DLC1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DLC1 (10395)
Length:
7164
CDS:
1661..4714

Additional Resources:

NCBI RefSeq record:
NM_001348082.2
NBCI Gene record:
DLC1 (10395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423034 GCGTACCTGTGTCGCTTTATT pLKO_005 5051 3UTR 100% 15.000 21.000 N DLC1 n/a
2 TRCN0000047825 GCCGATGTCGTAATTCCTATA pLKO.1 3999 CDS 100% 10.800 15.120 N DLC1 n/a
3 TRCN0000047827 CATGCCAGAATGGTACACAAA pLKO.1 4600 CDS 100% 4.950 3.960 N DLC1 n/a
4 TRCN0000421791 TGGTGGGTGTGAGGGTTAATG pLKO_005 4494 CDS 100% 13.200 9.240 N DLC1 n/a
5 TRCN0000428081 TTTCTACAGATCTACCAATAT pLKO_005 3635 CDS 100% 13.200 9.240 N DLC1 n/a
6 TRCN0000421147 GATCTTCCTGAGCCACTAATG pLKO_005 3593 CDS 100% 10.800 7.560 N DLC1 n/a
7 TRCN0000047823 GCAGAAATACTCACTCCTAAA pLKO.1 3220 CDS 100% 10.800 7.560 N DLC1 n/a
8 TRCN0000047826 GCAGACATGCTGAAGCAGTAT pLKO.1 3566 CDS 100% 4.950 2.970 N DLC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.