Transcript: Human NM_001348192.2

Homo sapiens ATP binding cassette subfamily G member 4 (ABCG4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
ABCG4 (64137)
Length:
3784
CDS:
480..2237

Additional Resources:

NCBI RefSeq record:
NM_001348192.2
NBCI Gene record:
ABCG4 (64137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434444 GTACAGCCTCAAAGCGTATTA pLKO_005 1679 CDS 100% 13.200 18.480 N ABCG4 n/a
2 TRCN0000447259 GTTCGTGGAGCTGTCCTATTC pLKO_005 427 5UTR 100% 10.800 15.120 N ABCG4 n/a
3 TRCN0000059603 CCGCCTGTCATGTTCTTTGAT pLKO.1 951 CDS 100% 5.625 7.875 N ABCG4 n/a
4 TRCN0000431520 GTCCACTGGAAGTCCCATTAT pLKO_005 2698 3UTR 100% 13.200 9.240 N ABCG4 n/a
5 TRCN0000059604 GCCAAGCTCTTTGAGATGTTT pLKO.1 1080 CDS 100% 5.625 3.938 N ABCG4 n/a
6 TRCN0000059605 CCCATTGAAAGCCACACCTTT pLKO.1 1374 CDS 100% 4.950 3.465 N ABCG4 n/a
7 TRCN0000105203 CCGCAAGATGTCCTGCTACAT pLKO.1 713 CDS 100% 4.950 3.465 N Abcg4 n/a
8 TRCN0000059606 GTATGGCTTTGAGGGTGTGAT pLKO.1 2012 CDS 100% 4.950 3.465 N ABCG4 n/a
9 TRCN0000059607 GTGGAGAACCACATCACTGAA pLKO.1 359 5UTR 100% 4.950 2.970 N ABCG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.