Transcript: Mouse NM_001348288.1

Mus musculus transient receptor potential cation channel, subfamily A, member 1 (Trpa1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Trpa1 (277328)
Length:
4177
CDS:
28..3315

Additional Resources:

NCBI RefSeq record:
NM_001348288.1
NBCI Gene record:
Trpa1 (277328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001348288.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193200 CCTCCGAAATAGAAACATGAT pLKO.1 405 CDS 100% 4.950 6.930 N Trpa1 n/a
2 TRCN0000174790 GCTAAGCTGTGTAAATCAAAT pLKO.1 595 CDS 100% 13.200 10.560 N Trpa1 n/a
3 TRCN0000194639 GCAAGGAAGTGGTTCTCACAA pLKO.1 1805 CDS 100% 4.950 3.465 N Trpa1 n/a
4 TRCN0000193568 GCTGAATATAATGGATGGTTA pLKO.1 300 CDS 100% 4.950 3.465 N Trpa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348288.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.