Transcript: Human NM_001348310.1

Homo sapiens LRR binding FLII interacting protein 2 (LRRFIP2), transcript variant 18, mRNA.

Source:
NCBI, updated 2018-06-11
Taxon:
Homo sapiens (human)
Gene:
LRRFIP2 (9209)
Length:
3165
CDS:
666..1940

Additional Resources:

NCBI RefSeq record:
NM_001348310.1
NBCI Gene record:
LRRFIP2 (9209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348310.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061982 CGGCAAAGAGATGAGCTTATT pLKO.1 1317 CDS 100% 13.200 18.480 N LRRFIP2 n/a
2 TRCN0000061981 GCTTAATAGATCCAGACACTT pLKO.1 967 CDS 100% 4.950 6.930 N LRRFIP2 n/a
3 TRCN0000061980 CCAATAGACAAATTAGCGAAT pLKO.1 1651 CDS 100% 4.050 5.670 N LRRFIP2 n/a
4 TRCN0000238945 CAAGACCTTCATCTCGAAATT pLKO_005 883 CDS 100% 13.200 9.240 N Lrrfip2 n/a
5 TRCN0000061978 CCGTAATTGTAGAATCATGTT pLKO.1 2183 3UTR 100% 4.950 3.465 N LRRFIP2 n/a
6 TRCN0000061979 CGGAAGCTACAACGAGAGTTA pLKO.1 1812 CDS 100% 4.950 3.465 N LRRFIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348310.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.