Transcript: Human NM_001348343.2

Homo sapiens syntaxin binding protein 5 like (STXBP5L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
STXBP5L (9515)
Length:
9357
CDS:
133..3693

Additional Resources:

NCBI RefSeq record:
NM_001348343.2
NBCI Gene record:
STXBP5L (9515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245787 ATGAGGATAGCACGAACATTT pLKO_005 3205 CDS 100% 13.200 18.480 N STXBP5L n/a
2 TRCN0000245788 GGACCGAATGGGTGGATTAAT pLKO_005 2838 CDS 100% 15.000 12.000 N STXBP5L n/a
3 TRCN0000100432 CGAATTACTTACTGTCATCTA pLKO.1 601 CDS 100% 4.950 3.960 N Stxbp5l n/a
4 TRCN0000245786 CAATGAAGGACAGGCATTATA pLKO_005 3234 CDS 100% 15.000 10.500 N STXBP5L n/a
5 TRCN0000245785 ACTTGATCTACATCGAGATTT pLKO_005 5921 3UTR 100% 13.200 9.240 N STXBP5L n/a
6 TRCN0000245784 GGTCATGCAGATGGATCAATA pLKO_005 1531 CDS 100% 13.200 9.240 N STXBP5L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.