Transcript: Human NM_001348691.1

Homo sapiens chromosome 1 open reading frame 216 (C1orf216), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
C1orf216 (127703)
Length:
2862
CDS:
417..1106

Additional Resources:

NCBI RefSeq record:
NM_001348691.1
NBCI Gene record:
C1orf216 (127703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263566 GACCCACCTCCTGGATTATGT pLKO_005 465 CDS 100% 5.625 7.875 N C1orf216 n/a
2 TRCN0000263565 ACAAGTCCAGGAGCGCTACAA pLKO_005 878 CDS 100% 4.950 6.930 N C1orf216 n/a
3 TRCN0000168513 GCAGGCTTGTATTAGGTGTAT pLKO.1 1495 3UTR 100% 4.950 6.930 N C1orf216 n/a
4 TRCN0000282675 CACAAGTGTGCAAGGGTATAT pLKO_005 1118 3UTR 100% 13.200 10.560 N C1orf216 n/a
5 TRCN0000263567 ACAACCGGAAGGAGCTTATTC pLKO_005 1036 CDS 100% 13.200 9.240 N C1orf216 n/a
6 TRCN0000172619 GCCAAGGATGCTAACGAGAAT pLKO.1 531 CDS 100% 4.950 3.465 N C1orf216 n/a
7 TRCN0000263564 GCCAAGGATGCTAACGAGAAT pLKO_005 531 CDS 100% 4.950 3.465 N C1orf216 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 155 5UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 155 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.