Transcript: Human NM_001348694.2

Homo sapiens family with sequence similarity 160 member A1 (FAM160A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
FAM160A1 (729830)
Length:
11409
CDS:
538..3660

Additional Resources:

NCBI RefSeq record:
NM_001348694.2
NBCI Gene record:
FAM160A1 (729830)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269778 CAGTATGACCAAATCATTAAA pLKO_005 2797 CDS 100% 15.000 10.500 N FAM160A1 n/a
2 TRCN0000269844 TGTGGTGTCTCTGGCATTATT pLKO_005 1689 CDS 100% 15.000 10.500 N FAM160A1 n/a
3 TRCN0000269842 GATCACGTCAAGCAGATATTG pLKO_005 3972 3UTR 100% 13.200 9.240 N FAM160A1 n/a
4 TRCN0000269776 TGCTGCTTATCGGGATCATTA pLKO_005 3155 CDS 100% 13.200 9.240 N FAM160A1 n/a
5 TRCN0000177181 GAAGATGTGATGTTACAGCTA pLKO.1 1735 CDS 100% 2.640 1.848 N Fam160a1 n/a
6 TRCN0000269843 GAACCAAGAGAGGGATTATAT pLKO_005 1902 CDS 100% 15.000 9.000 N FAM160A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.