Transcript: Human NM_001348699.2

Homo sapiens stabilizer of axonemal microtubules 2 (SAXO2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SAXO2 (283726)
Length:
3304
CDS:
63..1439

Additional Resources:

NCBI RefSeq record:
NM_001348699.2
NBCI Gene record:
SAXO2 (283726)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149078 GCCTGTAGCAAGGATTGTAAA pLKO.1 2606 3UTR 100% 13.200 18.480 N SAXO2 n/a
2 TRCN0000149216 GCATGCTGTTAAACAGCACAA pLKO.1 973 CDS 100% 0.405 0.567 N SAXO2 n/a
3 TRCN0000434848 AGTCATCGCCTTGATTATATA pLKO_005 690 CDS 100% 15.000 10.500 N SAXO2 n/a
4 TRCN0000130284 CCAAGGCAACAGGATTCATTA pLKO.1 1850 3UTR 100% 13.200 9.240 N SAXO2 n/a
5 TRCN0000422092 TATGGCAATTGTATGGTTATT pLKO_005 1753 3UTR 100% 13.200 9.240 N SAXO2 n/a
6 TRCN0000129833 CAGCTTGAACTCAAGTTTGAA pLKO.1 717 CDS 100% 5.625 3.938 N SAXO2 n/a
7 TRCN0000128153 CAAGATTATTCCTGCAGTGAA pLKO.1 1409 CDS 100% 4.950 3.465 N SAXO2 n/a
8 TRCN0000128128 CCATCTTGACTATGTTCCATA pLKO.1 995 CDS 100% 4.950 3.465 N SAXO2 n/a
9 TRCN0000147653 GCCTACTGTGAAATTTGGAAA pLKO.1 560 CDS 100% 4.950 3.465 N SAXO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.