Transcript: Human NM_001349170.2

Homo sapiens DDB1 and CUL4 associated factor 1 (DCAF1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DCAF1 (9730)
Length:
5602
CDS:
152..4675

Additional Resources:

NCBI RefSeq record:
NM_001349170.2
NBCI Gene record:
DCAF1 (9730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349170.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129280 CGTATCGCTAATGGCATTGCA pLKO.1 2861 CDS 100% 3.000 2.400 N DCAF1 n/a
2 TRCN0000265223 TGCAATTGGAAGACCTATTAT pLKO_005 1973 CDS 100% 15.000 10.500 N Vprbp n/a
3 TRCN0000251842 CTAAACCGCAGGGCATCATTT pLKO_005 3311 CDS 100% 13.200 9.240 N Vprbp n/a
4 TRCN0000129831 CGAGAAACTGAGTCAAATGAA pLKO.1 4711 3UTR 100% 5.625 3.938 N DCAF1 n/a
5 TRCN0000129344 CCACTTCTCATTGGCACTGAT pLKO.1 2609 CDS 100% 4.950 3.465 N DCAF1 n/a
6 TRCN0000129909 GCTGAGAATACTCTTCAAGAA pLKO.1 373 CDS 100% 4.950 3.465 N DCAF1 n/a
7 TRCN0000130734 GCGCCAATAAACTTTACGTCA pLKO.1 3287 CDS 100% 2.640 1.848 N DCAF1 n/a
8 TRCN0000129579 CCTCCCATTCTTCTGCCTTTA pLKO.1 2793 CDS 100% 10.800 6.480 N DCAF1 n/a
9 TRCN0000151143 GAGGAAGAAGATGATGATGAA pLKO.1 4379 CDS 100% 4.950 2.475 Y SAMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349170.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.