Transcript: Human NM_001349355.2

Homo sapiens contactin 6 (CNTN6), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CNTN6 (27255)
Length:
4234
CDS:
349..3435

Additional Resources:

NCBI RefSeq record:
NM_001349355.2
NBCI Gene record:
CNTN6 (27255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073403 CCCTCCATTGAAGTGGTATTT pLKO.1 1927 CDS 100% 13.200 18.480 N CNTN6 n/a
2 TRCN0000427837 TTATCTGCAGTAGCCGATATC pLKO_005 2104 CDS 100% 10.800 15.120 N CNTN6 n/a
3 TRCN0000073406 CCAGATAATAACAGTCCCATT pLKO.1 2212 CDS 100% 4.050 5.670 N CNTN6 n/a
4 TRCN0000073405 CCATCTACTTTGCTTCCGTAA pLKO.1 2966 CDS 100% 4.050 3.240 N CNTN6 n/a
5 TRCN0000412872 GTGAACCATCAGAATTGTTAA pLKO_005 2408 CDS 100% 13.200 9.240 N CNTN6 n/a
6 TRCN0000427062 GTTACAGTTGGCGAGAGTATA pLKO_005 1879 CDS 100% 13.200 9.240 N CNTN6 n/a
7 TRCN0000422095 TTGCAAAGGGTCAACTCATTT pLKO_005 1268 CDS 100% 13.200 9.240 N CNTN6 n/a
8 TRCN0000073407 CGATGCTGAATGTGTCAGATT pLKO.1 1469 CDS 100% 4.950 3.465 N CNTN6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.